Review



aav2 vector backbone  (Addgene inc)


Bioz Verified Symbol Addgene inc is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 96

    Structured Review

    Addgene inc aav2 vector backbone
    Aav2 Vector Backbone, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 277 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/paav+cag+vector/pAAV-CAG-tdTomato+(codon+diversified)+(Plasmid+%2359462)/pm41856998-209-6-10
    Average 96 stars, based on 277 article reviews
    aav2 vector backbone - by Bioz Stars, 2026-10
    96/100 stars

    Images

    Related Articles

    Construct:

    Article Title: Improved genetically encoded near-infrared fluorescent calcium ion indicators for in vivo imaging
    Article Snippet: .. To express each of NIR-GECO variants in primary hippocampal neurons and compare their brightness and photostability, the gene encoding NIR-GECO(1,2,2G)-T2A-GFP was constructed using overlap-extension PCR followed by subcloning into pAAV-CAG vector (Addgene no. 108420) using BamHI and EcoRI sites. .. The gene for miRFP720-P2A-GFP was synthesized de novo by GenScript, based on the reported sequence [ ], and cloned into the pAAV-CAG vector.

    Article Title: Improved genetically encoded near-infrared fluorescent calcium ion indicators for in vivo imaging
    Article Snippet: .. To express each of NIR-GECO variants in primary hippocampal neurons and compare their brightness and photostability, the genes of NIR-GECO(1,2,2G)-T2A-GFP and were constructed using overlap-extension PCR followed by subcloning into pAAV-CAG vector (Addgene no. 108420) using BamHI and EcoRI sites. .. The gene for miRFP720-P2A-GFP was synthesized de novo by GenScript, based on the reported sequence , and cloned into the pAAV-CAG vector.

    Polymerase Chain Reaction:

    Article Title: Improved genetically encoded near-infrared fluorescent calcium ion indicators for in vivo imaging
    Article Snippet: .. To express each of NIR-GECO variants in primary hippocampal neurons and compare their brightness and photostability, the gene encoding NIR-GECO(1,2,2G)-T2A-GFP was constructed using overlap-extension PCR followed by subcloning into pAAV-CAG vector (Addgene no. 108420) using BamHI and EcoRI sites. .. The gene for miRFP720-P2A-GFP was synthesized de novo by GenScript, based on the reported sequence [ ], and cloned into the pAAV-CAG vector.

    Article Title: A novel polycistronic method tailored for engineering split GECIs
    Article Snippet: .. For inserting back, the 114 bp to the 5’ UTR, CFP-GCaMP7s-tdTom - insert from GEFRI 3 was cloned by BamHI/HindIII restriction into a pAAV CAG vector (Plasmid #100840 Addgene) by PCR amplification using the following primers: 5’- TATATACGCGGATCCTGTGACCGGCGGCTCTAGA (forward) and 5’- TATATATCGATAAGCTTGATATCGAATTC (reverse). .. The backbone pSBbi-Pur (Plasmid #60523 Addgene) was amplified for inserting the restriction sites HindIII and XBaI using the following primers: 5’-TATATA TCTAGA AGGCCAGCTTGGGGTAGTTT (forward) and 5’-TATATA AAGCTT GCTCGCTGATCAGCCTCGA (reverse), respectively.

    Article Title: Improved genetically encoded near-infrared fluorescent calcium ion indicators for in vivo imaging
    Article Snippet: .. To express each of NIR-GECO variants in primary hippocampal neurons and compare their brightness and photostability, the genes of NIR-GECO(1,2,2G)-T2A-GFP and were constructed using overlap-extension PCR followed by subcloning into pAAV-CAG vector (Addgene no. 108420) using BamHI and EcoRI sites. .. The gene for miRFP720-P2A-GFP was synthesized de novo by GenScript, based on the reported sequence , and cloned into the pAAV-CAG vector.

    Subcloning:

    Article Title: Improved genetically encoded near-infrared fluorescent calcium ion indicators for in vivo imaging
    Article Snippet: .. To express each of NIR-GECO variants in primary hippocampal neurons and compare their brightness and photostability, the gene encoding NIR-GECO(1,2,2G)-T2A-GFP was constructed using overlap-extension PCR followed by subcloning into pAAV-CAG vector (Addgene no. 108420) using BamHI and EcoRI sites. .. The gene for miRFP720-P2A-GFP was synthesized de novo by GenScript, based on the reported sequence [ ], and cloned into the pAAV-CAG vector.

    Article Title: Improved genetically encoded near-infrared fluorescent calcium ion indicators for in vivo imaging
    Article Snippet: .. To express each of NIR-GECO variants in primary hippocampal neurons and compare their brightness and photostability, the genes of NIR-GECO(1,2,2G)-T2A-GFP and were constructed using overlap-extension PCR followed by subcloning into pAAV-CAG vector (Addgene no. 108420) using BamHI and EcoRI sites. .. The gene for miRFP720-P2A-GFP was synthesized de novo by GenScript, based on the reported sequence , and cloned into the pAAV-CAG vector.

    Plasmid Preparation:

    Article Title: Improved genetically encoded near-infrared fluorescent calcium ion indicators for in vivo imaging
    Article Snippet: .. To express each of NIR-GECO variants in primary hippocampal neurons and compare their brightness and photostability, the gene encoding NIR-GECO(1,2,2G)-T2A-GFP was constructed using overlap-extension PCR followed by subcloning into pAAV-CAG vector (Addgene no. 108420) using BamHI and EcoRI sites. .. The gene for miRFP720-P2A-GFP was synthesized de novo by GenScript, based on the reported sequence [ ], and cloned into the pAAV-CAG vector.

    Article Title: A novel polycistronic method tailored for engineering split GECIs
    Article Snippet: .. For inserting back, the 114 bp to the 5’ UTR, CFP-GCaMP7s-tdTom - insert from GEFRI 3 was cloned by BamHI/HindIII restriction into a pAAV CAG vector (Plasmid #100840 Addgene) by PCR amplification using the following primers: 5’- TATATACGCGGATCCTGTGACCGGCGGCTCTAGA (forward) and 5’- TATATATCGATAAGCTTGATATCGAATTC (reverse). .. The backbone pSBbi-Pur (Plasmid #60523 Addgene) was amplified for inserting the restriction sites HindIII and XBaI using the following primers: 5’-TATATA TCTAGA AGGCCAGCTTGGGGTAGTTT (forward) and 5’-TATATA AAGCTT GCTCGCTGATCAGCCTCGA (reverse), respectively.

    Article Title: Improved genetically encoded near-infrared fluorescent calcium ion indicators for in vivo imaging
    Article Snippet: .. To express each of NIR-GECO variants in primary hippocampal neurons and compare their brightness and photostability, the genes of NIR-GECO(1,2,2G)-T2A-GFP and were constructed using overlap-extension PCR followed by subcloning into pAAV-CAG vector (Addgene no. 108420) using BamHI and EcoRI sites. .. The gene for miRFP720-P2A-GFP was synthesized de novo by GenScript, based on the reported sequence , and cloned into the pAAV-CAG vector.

    Clone Assay:

    Article Title: A novel polycistronic method tailored for engineering split GECIs
    Article Snippet: .. For inserting back, the 114 bp to the 5’ UTR, CFP-GCaMP7s-tdTom - insert from GEFRI 3 was cloned by BamHI/HindIII restriction into a pAAV CAG vector (Plasmid #100840 Addgene) by PCR amplification using the following primers: 5’- TATATACGCGGATCCTGTGACCGGCGGCTCTAGA (forward) and 5’- TATATATCGATAAGCTTGATATCGAATTC (reverse). .. The backbone pSBbi-Pur (Plasmid #60523 Addgene) was amplified for inserting the restriction sites HindIII and XBaI using the following primers: 5’-TATATA TCTAGA AGGCCAGCTTGGGGTAGTTT (forward) and 5’-TATATA AAGCTT GCTCGCTGATCAGCCTCGA (reverse), respectively.

    Amplification:

    Article Title: A novel polycistronic method tailored for engineering split GECIs
    Article Snippet: .. For inserting back, the 114 bp to the 5’ UTR, CFP-GCaMP7s-tdTom - insert from GEFRI 3 was cloned by BamHI/HindIII restriction into a pAAV CAG vector (Plasmid #100840 Addgene) by PCR amplification using the following primers: 5’- TATATACGCGGATCCTGTGACCGGCGGCTCTAGA (forward) and 5’- TATATATCGATAAGCTTGATATCGAATTC (reverse). .. The backbone pSBbi-Pur (Plasmid #60523 Addgene) was amplified for inserting the restriction sites HindIII and XBaI using the following primers: 5’-TATATA TCTAGA AGGCCAGCTTGGGGTAGTTT (forward) and 5’-TATATA AAGCTT GCTCGCTGATCAGCCTCGA (reverse), respectively.



    Similar Products

    96
    Addgene inc aav2 vector backbone
    Aav2 Vector Backbone, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/paav+cag+vector/pAAV-CAG-tdTomato+(codon+diversified)+(Plasmid+%2359462)/pm41856998-209-6-10
    Average 96 stars, based on 1 article reviews
    aav2 vector backbone - by Bioz Stars, 2026-10
    96/100 stars
      Buy from Supplier

    96
    Addgene inc paav cag egfp vector
    Paav Cag Egfp Vector, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/paav+cag+vector/AAV+pCAG-FLEX-EGFP-WPRE+(Plasmid+%2351502)/pm41741636-453-58-60
    Average 96 stars, based on 1 article reviews
    paav cag egfp vector - by Bioz Stars, 2026-10
    96/100 stars
      Buy from Supplier

    93
    Addgene inc n a aav hsyn dio enphr3 0 yfp addgene 26972 aav1 aav9 cag dio enphr3 0 mruby3 upenn viral vector core n a aav9 hsyn
    N A Aav Hsyn Dio Enphr3 0 Yfp Addgene 26972 Aav1 Aav9 Cag Dio Enphr3 0 Mruby3 Upenn Viral Vector Core N A Aav9 Hsyn, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/paav+cag+vector/pAAV-hSyn-eNpHR+3%2E0-EYFP+(Plasmid+%2326972)/pm41702398-232-14-16
    Average 93 stars, based on 1 article reviews
    n a aav hsyn dio enphr3 0 yfp addgene 26972 aav1 aav9 cag dio enphr3 0 mruby3 upenn viral vector core n a aav9 hsyn - by Bioz Stars, 2026-10
    93/100 stars
      Buy from Supplier

    96
    Addgene inc 27056 aav5 aav1 cag dio mcherrymbdnf shrnamir vector biolabs shaav 253926 chemicals
    27056 Aav5 Aav1 Cag Dio Mcherrymbdnf Shrnamir Vector Biolabs Shaav 253926 Chemicals, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/paav+cag+vector/pAAV-Ef1a-DIO+EYFP+(Plasmid+%2327056)/pm41687612-163-71-69
    Average 96 stars, based on 1 article reviews
    27056 aav5 aav1 cag dio mcherrymbdnf shrnamir vector biolabs shaav 253926 chemicals - by Bioz Stars, 2026-10
    96/100 stars
      Buy from Supplier

    96
    Addgene inc viral vectors paav cag flex egfp wpre
    Excitatory and inhibitory cerebellar projections at P0 . (A) 3D visualization of excitatory (eCb; Ntsr1 Cre +AAV-FLEX-EGFP ) and (B) inhibitory (iCb; Vgat1 Cre +AAV-FLEX-EGFP ) axonal bundles at P0 in the whole brain.
    Viral Vectors Paav Cag Flex Egfp Wpre, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/paav+cag+vector/AAV+pCAG-FLEX-EGFP-WPRE+(Plasmid+%2351502)/pmc12685143-151-17-21
    Average 96 stars, based on 1 article reviews
    viral vectors paav cag flex egfp wpre - by Bioz Stars, 2026-10
    96/100 stars
      Buy from Supplier

    92
    Addgene inc aav vector backbone
    Excitatory and inhibitory cerebellar projections at P0 . (A) 3D visualization of excitatory (eCb; Ntsr1 Cre +AAV-FLEX-EGFP ) and (B) inhibitory (iCb; Vgat1 Cre +AAV-FLEX-EGFP ) axonal bundles at P0 in the whole brain.
    Aav Vector Backbone, supplied by Addgene inc, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/paav+cag+vector/pAAV-CAG-fDIO-oG-WPRE-SV40pA+(Plasmid+%2374291)/pmc12506486__mmc1-27-37-40
    Average 92 stars, based on 1 article reviews
    aav vector backbone - by Bioz Stars, 2026-10
    92/100 stars
      Buy from Supplier

    96
    Addgene inc 44361 aav5 aav1 ef1a flex tva mcherry unc vector core n a aav1 cag
    Excitatory and inhibitory cerebellar projections at P0 . (A) 3D visualization of excitatory (eCb; Ntsr1 Cre +AAV-FLEX-EGFP ) and (B) inhibitory (iCb; Vgat1 Cre +AAV-FLEX-EGFP ) axonal bundles at P0 in the whole brain.
    44361 Aav5 Aav1 Ef1a Flex Tva Mcherry Unc Vector Core N A Aav1 Cag, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/paav+cag+vector/pAAV-hSyn-DIO-hM3D(Gq)-mCherry+(Plasmid+%2344361)/pm40934915-824-141-139
    Average 96 stars, based on 1 article reviews
    44361 aav5 aav1 ef1a flex tva mcherry unc vector core n a aav1 cag - by Bioz Stars, 2026-10
    96/100 stars
      Buy from Supplier

    97
    Addgene inc retro paav cag gfp viral vectors
    Excitatory and inhibitory cerebellar projections at P0 . (A) 3D visualization of excitatory (eCb; Ntsr1 Cre +AAV-FLEX-EGFP ) and (B) inhibitory (iCb; Vgat1 Cre +AAV-FLEX-EGFP ) axonal bundles at P0 in the whole brain.
    Retro Paav Cag Gfp Viral Vectors, supplied by Addgene inc, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/paav+cag+vector/pAAV-CAG-GFP+(Plasmid+%2337825)/pm40478871-193-32-41
    Average 97 stars, based on 1 article reviews
    retro paav cag gfp viral vectors - by Bioz Stars, 2026-10
    97/100 stars
      Buy from Supplier

    Image Search Results


    Excitatory and inhibitory cerebellar projections at P0 . (A) 3D visualization of excitatory (eCb; Ntsr1 Cre +AAV-FLEX-EGFP ) and (B) inhibitory (iCb; Vgat1 Cre +AAV-FLEX-EGFP ) axonal bundles at P0 in the whole brain.

    Journal: Proceedings of the National Academy of Sciences of the United States of America

    Article Title: Brain-wide mapping of developmental trajectories of cerebellar efferent projections

    doi: 10.1073/pnas.2521091122

    Figure Lengend Snippet: Excitatory and inhibitory cerebellar projections at P0 . (A) 3D visualization of excitatory (eCb; Ntsr1 Cre +AAV-FLEX-EGFP ) and (B) inhibitory (iCb; Vgat1 Cre +AAV-FLEX-EGFP ) axonal bundles at P0 in the whole brain.

    Article Snippet: To anterogradely trace cerebellar long-range projections, we utilized an EGFP lentivirus (LV-H1p-UbCpEGFP) in wild-type mice and Cre-dependent viral vectors pAAV CAG-FLEX-EGFP-WPRE (Addgene #51502, AAV1) or pAAV hSyn.FLEX.mGFP.2A.Synaptophysin-mRuby (Addgene #71760, AAV1) in Ntsr1 Cre and Vgat1 Cre mice.

    Techniques:

    Development of eCb–hindbrain projections . 3D visualization of the development of excitatory cerebellar (eCb; Ntsr1 Cre +AAV-FLEX-EGFP ) efferent projections innervating the hindbrain. The movie highlights the progressive expansion of eCb axonal pathways across hindbrain regions.

    Journal: Proceedings of the National Academy of Sciences of the United States of America

    Article Title: Brain-wide mapping of developmental trajectories of cerebellar efferent projections

    doi: 10.1073/pnas.2521091122

    Figure Lengend Snippet: Development of eCb–hindbrain projections . 3D visualization of the development of excitatory cerebellar (eCb; Ntsr1 Cre +AAV-FLEX-EGFP ) efferent projections innervating the hindbrain. The movie highlights the progressive expansion of eCb axonal pathways across hindbrain regions.

    Article Snippet: To anterogradely trace cerebellar long-range projections, we utilized an EGFP lentivirus (LV-H1p-UbCpEGFP) in wild-type mice and Cre-dependent viral vectors pAAV CAG-FLEX-EGFP-WPRE (Addgene #51502, AAV1) or pAAV hSyn.FLEX.mGFP.2A.Synaptophysin-mRuby (Addgene #71760, AAV1) in Ntsr1 Cre and Vgat1 Cre mice.

    Techniques: